Quality control of the chromatin immunopurification from Drosophila embryos
Overview
Assay of ChIP for HSF by direct PCR-based detection of known heat shock factor binding fragments. This procedure is used to assess batch quality following chromatin immunopurification and before ligation-mediated PCR. (As the embryo chromatin preparation protocol activates HSF in the absence of heat-shock, this procedure can also be used to quality control non-heat-shocked chromatin preparations.)
Protocol
PCR primers
| PCR amplicon | 5' primer | 3' primer |
|---|---|---|
| Heat stock element for heat shock protein 26 | GCTGTTTCTTTTGCGCTCTT | TTGTTTGACTTGTAAGCAAAGGTT |
| 3'-end of heat shock protein 26 (negative control) | CGCATCATTCAAATTCAGCAAGT | GGTGAACTATTTTCGGACACCAA |
15 µl of PCR reaction was prepared:
- 3 µl immunopurified DNA
- 1 µl 100 pmol/µl primers
- 1.5 µl Buffer IV (ABgene)
- 1.2 µl 25 mM Mg2+
- 1.5 µl 2.5 mM dNTPs
- 1 µl 5U/µl Thermostart Taq polymerase (ABgene; Cat. No. AB-0908a)
- 5.8 µl water
PCR cycle
- 95 °C for 5 minutes
- 95 °C for 1 minute
- 57 °C for 1 minute
- 72 °C for 1 minute
- Repeat steps 2 to 4, 35 times
- 72 °C for 10 minutes
- 4 °C and hold
Assay products by agarose gel electrophoresis.
Version 1.2. R. Auburn. (08-09-2006)
