Amplification of Arabidopsis spike controls
Outline
The spike controls were amplified by PCR from double stranded cDNA clones and by PCR from Arabidopsis columbia genomic DNA. The double stranded cDNA clones were obtained from:
- Arabidopsis Biological Resource Centre (Aims) (http://aims.cps.msu.edu/)
- Incyte Genomics (Incyte) (http://www.incyte.com/)
- Functional Genomics of Plant Stress Tolerance (Arizona) (http://www.stress-genomics.org/)
PCR amplification from double stranded cDNA clones
The double stranded cDNA clone inserts were amplified using a 1 in 100 dilution of a Qiagen purified plasmid midi prep. M13 forward and reverse primers were used for all Incyte, Aims and Arizona clones.
PCR primers:
| Clone | CloneID | Vector | Antibiotic | 5' primer | 3' primer | PCR amplicon (kb) |
| Arizona4 | M90509 | pSK+ | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.0 |
| Arizona6 | U74610 | pSK+ | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.1 |
| Incyte4 | ATU18126 | pSTBlue-1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 0.6 |
| Incyte5 | L22585 | pSTBlue-1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.0 |
| AIMS 1 | AB007987 | pZL1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.3 |
| AIMS 4 | AF117335 | pZL1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.7 |
| AIMS 5 | AF168390 | pZL1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.5 |
| AIMS 9 | AF372915 | pZL1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.3 |
| AIMS 10 | Y18469 | pZL1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.6 |
| AIMS 11 | Z49777 | pZL1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.2 |
| AIMS 19 | X644464 | pZL1 | Ampicillin | tgtaaaacgacggccagt | caggaaacagctatgac | 1.0 |
PCR reaction mix:
- 10 µl Sigma PCR Buffer (or ABgene Thermostart standard buffer)
- 6 µl 25 mM Mg
- 2 µl 10mM dNTPs
- 2 µl 25 pmol / µl primers
- 78 µl MilliQ water
- 1 µl Sigma Taq polymerase (or ABgene Thermostart DNA polymerase)
- 1 µl DNA template
PCR cycle:
All PCR reactions were performed in 0.2 ml microfuge tubes with a Dyad thermal cycler with the following PCR cycle.
- 95 °C for 15 minutes
- 94 °C for 30 seconds
- 60 °C for 30 seconds
- 72 °C for 4 minutes
- Repeat steps 2 to 4, 34 times
- 72 °C for 10 minutes
- 4 °C cold storage before unloading
PCR products were purified using Qiagen QIA quick columns or Millipore Multiscreen-PCR plates and checked by both agarose gel electrophoresis and the Nanodrop. The DNA concentration was then adjusted to make a final stock concentration for printing.
PCR amplification from Arabidopsis columbia Genomic DNA
PCR primers:
| Clone | CloneID | Vector | Antibiotic | 5' primer | 3' primer | PCR amplicon (b) |
| Weed 1 | O82258 | pCR2.1-TOPO | Ampicillin | taaagtggaacctccgatgc | gaagagctcatcgccgatac | 514 |
| Weed 3 | Q9LJQ4 | - | Ampicillin | ttcttcacaactcgtcaattcaa | gcaaactgatgaccaggaaga | 402 |
| Weed 4 | Q9XIB8 | pCR2.1-TOPO | Ampicillin | aagacgaggcgagatcttca | tgttcctttcagagtgcaaatg | 396 |
| Weed 6 | O04600 | pCR2.1-TOPO | Ampicillin | ttgagtaccaacggtttcagc | tatcatcggtttgcctttgc | 370 |
| Weed 7 | Q9LZJ2 | pCR2.1-TOPO | Ampicillin | tcatgtgaacatacaacgcaat | ggtctattgggggtggaatc | 404 |
| Weed 8 | Q9LVF8 | pCR2.1-TOPO | Ampicillin | tcaacctatcattcctcccatt | gcctattgaggatttgttgctt | 394 |
| Weed 9 | O49366 | pCR2.1-TOPO | Ampicillin | agcttgagaacataggccaca | tggcatcggttgtctctgta | 343 |
| Weed 10 | O81842 | pCR2.1-TOPO | Ampicillin | agcatccaaaatccaaccaa | ttcgattccgcagattatcc | 361 |
| Weed 13 | Q9LU32 | pCR2.1-TOPO | Ampicillin | tccaatatgatttggttgtgga | tgtatgcttgcactcgatga | 330 |
| Weed 14 | O04513 | pCR2.1-TOPO | Ampicillin | agggcatttggtttcatggt | atagcatgctcgatgtgcaa | 306 |
PCR reaction mix:
- 10 µl Stratagene Yield Ace reaction buffer (or ABgene Thermostart standard buffer)
- 2 µl 10mM dNTPs
- 2 µl 25 pmol / µl primers (spike specific 5'+3')
- 84 µl MilliQ water
- 1 µl Stratagene Yield Ace polymerase (or ABgene Thermostart DNA polymerase)
- 1 µl DNA template
PCR cycle:
All PCR reactions were performed in 0.2 ml microfuge tubes with a Dyad thermal cycler with the following PCR cycle.
- 95 °C for 15 minutes
- 95 °C for 45 seconds
- 60 °C for 40 seconds
- 72 °C for 1 minute
- Repeat steps 2 to 4, 34 times
- 72 °C for 10 minutes
- 4 °C cold storage before unloading
PCR products were purified using Qiagen QIA quick columns or Millipore Multiscreen-PCR plates and checked by both agarose gel electrophoresis and the Nanodrop. The DNA concentration was then adjusted to make a final stock concentration for printing.
R. Auburn (17-02-2006).
